Primer and probe sequences for tPA, uPA, PAI-1 and b-actin for RT-PCR | Download Table
Beta-Actin - an overview | ScienceDirect Topics
Product Manual Human beta actin RT-PCRmer™
Forward (F) and Reverse (R) Primer Sequences of β-actin and hTERT Used... | Download Scientific Diagram
beta Actin (ACTB) Human qPCR Primer Pair (NM_001101) – HP204660 | OriGene
β-actin gene sequence and position of the forward and reverse primers... | Download Scientific Diagram
Addgene: Reduced Expression GFP beta actin
Figure 2 from PrimerBank: a resource of human and mouse PCR primer pairs for gene expression detection and quantification | Semantic Scholar
Time for rethinking the different β‐actin transgenic mouse models? - Vanslembrouck - 2020 - Cytoskeleton - Wiley Online Library
WJMH :: The World Journal of Men's Health
ceo-7-112-i002.jpg
JCI Insight - Brd4-p300 inhibition downregulates Nox4 and accelerates lung fibrosis resolution in aged mice
Time for rethinking the different β‐actin transgenic mouse models? - Vanslembrouck - 2020 - Cytoskeleton - Wiley Online Library
Addgene: eTC GFP beta-actin full length
Human ACTB (Beta Actin) Endogenous Control (FAM™/MGB probe, non-primer limited)
The sequences of PCR primers used for the detection of β-actin, Wnt,... | Download Table
Tables_Page_2.jpg
Design and Testing of β-Actin Primers for RT-PCR that Do Not Co-amplify Processed Pseudogenes
Selective measurement of α smooth muscle actin: why β-actin can not be used as a housekeeping gene when tissue fibrosis occurs | BMC Molecular Biology | Full Text
The Early-Onset Myocardial Infarction Associated PHACTR1 Gene Regulates Skeletal and Cardiac Alpha-Actin Gene Expression | PLOS ONE
Primer Pair for Beta Actin (ACTB) | PGB340Mi01 | Homo sapiens (Human), Mus musculus (Mouse), Rattus norvegicus (Rat) CLOUD-CLONE CORP.(CCC)
Table S1. Sequence of primers used in real-time PCR Forward Primer Reverse Primer Human IL1β AGCTACGAATCTCCGACCAC CGTTATCCCATG
Primer Sequences for Hb and β-Actin cDNA and Resulting Fragment Lengths. | Download Table
Human beta-Actin qPCR Primer Pair | Sino Biological
Sequence or primers used for qPCR analysis Name β-actin gene Forward... | Download Table
